miércoles, 24 de diciembre de 2014


Navidad, 2001: Que Reine la Verdadera Paz
December 20, 2001

El presente Mensaje de Navidad constituye el quinto volumen que de manera escrita y pública, cada vez año tras año, mi Ser Real viene produciendo ininterrumpidamente desde 1.977, con su tonalidad de Luz práctica, clara y específica, esperanzado en que, de algún modo, misericordiosamente penetre las tinieblas humanas que en verdad quieran abrirse a la vivencia de los Fulgores Divinos, más allá de cualquier especulación, teoría o simples intenciones.

No me seduce la candidez de considerar que tendré una abrumadora aceptación del mismo, pese a mi acariciado anhelo de que a mayor cantidad posible de aspirantes sinceros e Iniciados auténticos aproveche su orientación inductiva, pero como ya tengo la triste experiencia, me he acostumbrado no sólo a la normal indiferencia de la globalidad egoísta y satanizada, sino al sensible como diligente sabotaje que a su difusión se opone, paradójicamente manipulado por quienes deberían esforzarse para lograr su masivo conocimiento.

Aclaro que no me mueve al respecto ningún solapado o explícito interés de figuración, rivalidad y/o confrontación, menos aún que me halle proclive a la pesca de incautos, soñadores, beligerantes y devoradores más que seguidores de una pretendida autenticidad doctrinal, misma que algunos desorientados ostentan vanidosos y soberbios, destruyendo con saña y sin pausa cuanto con tanto amor y esmero nos ha costado construir a quienes, a través de los tiempos y como Siervos de Dios Vivo, se nos encomendó forjar, clarificando el Sendero Iniciático para que puedan recorrerlo con mayor precisión quienes atisben su derrotero triunfal.

Desde el rótulo de este Mensaje ya viene implícita una invitación que se decreta auspiciosamente para que reine entre los hombres la verdadera paz, pero es de advertirse con rigurosidad que a medida que no se eliminen conscientemente los factores infra psíquicos que provocan los odios y las guerras, sus calamitosas consecuencias proseguirán encadenadas indefinidamente, provocando en progresión geométrica más muerte y desolación, angustia y terror, desesperanza e inseguridad en toda la vastedad de la Tierra.

Y es que, lastimosamente hasta ahora, de nada han valido las claras advertencias y el llamado clamoroso que permanentemente desde los Cielos se ha formulado a los obstinados transgresores de la Ley Divina, para que de una buena vez actuando conscientemente, hayan coadyuvado positivamente a disminuir las derivaciones altamente karmáticas que hoy constituyen la estandarización de la inocultable vocación guerrera de sus componentes bestializados, quienes invocando inspiraciones pseudo religiosas – Válgame Dios Misericordioso y la Virgen Sacratísima - tienen acongojada a la humanidad toda, sometida a soportar los descalabros de la locura desatada por algunos mal llamados espiritualistas, entre otros tantos apologistas de la barbarie y la degradación fanática, quienes con ciertos visos de justificación troglodita, provenientes tanto de oriente como de occidente, no se arredran ante el dolor y la muerte que van ejecutando por doquier, tornando aún más angustiosa la interminable secuela de miseria, injusticias y atropellos que campean impávidos e impertérritos por este malhadado mundo, añadidos a los trastornos geológicos, las pestes y los deplorables vicios que hoy se festejan y promueven ciegamente por casi todos los medios sociales existentes, como si fuesen augustos avances del arrollador vandálico modernismo.

Clarificada la patética situación psicótica apoderada en el común denominador de los habitantes terrestres, es posible determinar que antes de una pretendida evolución que se desarrollaría de modo más o menos mecánico, se experimenta sensiblemente una debacle cuyo referente se aproxima a una decadencia cultural devastadora, muy difícil pero no imposible de poderse revertir, por cuanto se ha llegado a extremos inusitados ya no sólo de ignorancia generalizada, estupidez y cretinismo alarmante, sino de espantosa enajenación irresponsable, lindante ya a las febriles influencias del dopaje con aberrantes drogas alucinógenas, cuya fantasiosa deformación de la realidad, tiene convencidos a los adictos del mal de estar ejecutando irrefutable accionar, hagan cuanto hicieren, pues ilusos en el delirio de predominio mundial, se arrogan representación divinal, ni más ni menos que el entorpecido Nerón, coronado con la arrogancia del azaroso como fugaz imperio material, quien en su obcecación como bestia infernal y en un paroxismo de impiedad e idiotismo, no trepidó en descuartizar hasta a su propia madre para ostentar su terrífico hegemónico poder.

Pese a los obstinados esfuerzos de las tinieblas encaramadas por doquier esquematizando su falsedad disfrazada de filantropía y benignidad, a estas alturas de cierta madurez alcanzada al menos en algunas escasas porciones de auténtica élite espiritual felizmente encarnadas en la Tierra merced a la íntima Kristificación, no es dable ya aceptar ni para la razón, menos para la lógica superior, que prevalezcan absurdos sofismas de quienes preconizan abanderar de modo universal supuestas virtudes que de hecho manifiesto desconocen en absoluto; es hora ya de que las nobles armas de Suprema Consciencia e infinito Amor dobleguen con enérgica dulzura la brutalidad de la fuerza y las astucias del engaño, origen del odio y el separatismo, males detestables que siembran la beligerancia intermitente entre las sórdidas masas, adormecidas astutamente por los cantos de sirena que emite sinuosamente el sistema materialista adorador de Baal, Baco, Koré y Manmón entre tantas otras cabezas de legión infernal, pretendiendo desviar el derrotero triunfal que aguarda según designios Divinos a la humanidad en general, una vez que haya sido rescatada efectivamente de las garras de Satanás, al que por mientras sirven desgraciadamente con fervor inusitado y pasión declarada.

Pero es claro y manifiesto comprobar que la anomalía es la regla común en las relaciones de una sociedad hace mucho ya carente de sentido ético o moral, donde las aberraciones y la concupiscencia campean en sus bajezas con visos de plena autonomía y cómplice concertación, por parte inclusive de la gran mayoría de tiendas confesionales, que por el temor de perder a sus adherentes que proveen diezmos y beneficios terrenales, como ser dinero, fama, sexo y poder, les aceptan todas sus impúdicas veleidades, sus horrendos crímenes, sus maniáticas confrontaciones, sus desquiciados experimentos infra genéticos, etc., habiendo olvidado que al maligno sólo se puede vencer con la Voluntad Krística, cuando el auténtico Laborante como Verbo Viviente, se impone triunfal ante el sofisticado tentador interior al afirmar de modo contundente y férrea convicción que "No sólo de pan vive el Hombre…….", conjurándole además con la fulminante Potencia Solar: "ITABABO, HÁGASE LUZ………"

Tan hermosas y sabias Enseñanzas entregadas por el Hálito Divino encarnado periódicamente en la Tierra para socorrer a la humanidad, mismas que deberían ser el norte que guíe a los aspirantes de Luz para poderla encontrar y encarnar, son infelizmente desechadas por unas hordas salvajes que se encuentran ebrias en sus deleites infernales, obstinadas en la desobediencia hacia el Creador, pero cual modernos fariseos ostentan soberbios su "impecabilidad" que recuerda al desquiciado Robespierre, tristemente célebre "desfacedor" de los nobles ideales de justicia a los que tan erráticamente se pretendieron servir.

Como es frecuente para la Divinidad insistir en la regeneración humana pese a los devaneos y desinterés obcecado de sus incongruentes beneficiarios, y aunque con la práctica entregada en mi anterior Mensaje no se encontró un mínimo de participantes que en su ejecución consciente hubiesen aliviado por lo menos parcialmente lo que ya los signos de los tiempos finales evidencian con su presencia fantasmagórica, y toda vez que después de estos tormentosos nubarrones de cambios radicales que nos toca experimentar atónitos en la Tierra, con los trágicos luctuosos sucesos acontecidos recientemente y los que con efecto dominó desgraciadamente se aprestan en bumerán enseguida, atendiendo Mandatos Supremos provenientes del Altísimo, voy a porfiar en mi entrega esta vez de la siguiente práctica cuyo objetivo es rehabilitar en los que busquen resurgir por su Obra Magna, el mismísimo joyel de la Clavícula de Salomón.

He aquí el Tesoro Celestial que pongo a disposición de quienes se hallen dignos y dispuestos a romper los sellos de la aprisionante caverna particular, rescatando con hechos concretos y precisos las alegóricas referencias al respecto con que la enseñanza trascendental siempre ha dispuesto para los acuciosos e intrépidos, citando para el caso presente lo que sabiamente expone Platón en el octavo capítulo de su "República" o lo que las "Mil y Una Noches" de modo tan explícito para los Alquimistas devela con la osadía ejecutada por el Iniciado Alí Babá para recuperar lo que los ladrones, egoístas y avaros habían arrebatado al Hijo de Dios.


A) Filosofía introductiva
Como quiera que en el Mes de Marzo del año 2002 en realidad ingresaremos al Noveno de la Nueva Era Acuaria que es cuando se presentará de modo propicio un Equiflux Cósmico (Equilibrio armónico bio-magnético-psico-sexual) que viene siendo una expresión más adecuada para explicar lo que es un Jubileo Celestial, corro con el riesgo y asumo la delicada responsabilidad de plantear a quienes, ansiosos de iniciación cierta pero cansados de falacias y/o teorías vanas, y luego de que hayan aceptado los indubitables dones de la bien entendida Castidad Científica y estén practicando sus benéficos resultados, puedan acceder a una tangible comprobación contundente "Aquí y ahora".

Considero que quien esto lea y analice, no se esforzará en comprender la natural anatomía cartilaginosa del esternón que llevamos en el pecho uniendo las costillas que emergen de la Columna Vertebral, y en cuya cavidad llevamos físicamente por delante el corazón y el hígado, mientras que por atrás tenemos los pares de pulmones y riñones.

Quienes siguiendo la esencia de mis anteriores Mensajes ya hubieran adelantado - en su día y en su hora precisa de cada mes - algo de las prácticas que mi Ser entrega con la intervención del Maestro Melkisedek para la reparación de corazón, hígado y riñones, de conformidad a lo que veladamente se aconseja en el Libro de Revelaciones o Apocalipsis de las Sagradas Escrituras, y en cuya constancia es posible lograrse verdaderos milagros de regeneración anímico celular, podrán comprobar sin sugestiones a priori, las maravillas que esta vez con el INTERION pueden operar los pulmones, habiendo sido habilitados para responder a los supremos impulsos de la Memoria Cósmica, recuperada la condición de procesar el Maná Celestial, esto es, las características etéricas contenidas en el oxígeno hidrogenado heliónicamente mediante el Sagrado Eroar.

Aclaro: mediante el esternón nuestra naturaleza orgánica está consignada a recibir los beneficios materiales que devienen del impulso respiratorio regular o semiconsciente, que permite a la vez la sabia combinación equilibrada del indispensable funcionalismo vegetativo del cuerpo, en cuyo resultado lógico puede otorgar al individuo común una salud abundante con toda la extraordinaria satisfacción que eso significa y que culmina en el verdadero deleite de vivir, esto es, recuperando la felicidad del Paraíso terrenal, irguiéndose nuevamente como Hombre en la escala evolutiva por encima de la condición meramente animal.

Otra cosa supremamente superior es poder vencer la fatalidad de los estigmas del pecado que ha llevado por eones a los hombres de barro a soportar la aparente insalvable situación de necesidad material, constreñidos al parto doloroso, el hambre, la enfermedad y la muerte, anatemas que persisten en los alicaídos descendientes de Adán y Eva que conformamos las humanidades del inconmensurable espacio existente por debajo de la cuarta coordenada dimensional.

Por si todavía no ha sido advertido por los investigadores serios, y a fin de premiar su dedicación y búsqueda sincera, debo enfatizar que la naturaleza tridimensional alberga lo que vendría en denominarse el Paraíso terrenal que corresponde a las especies que mantienen su original inocencia, libres de todo pecado, aunque sin poder acceder a las escalas de la Divinidad, esto es, sin llegar a disfrutar los encantos del Arbol de la Vida mediante el cual se permite a los intrépidos superar la mera creación material.

B) Preparativos para la práctica

A) La pareja laborante requiere disponer de un ambiente más o menos espacioso, sea cubierto o despejado para llevar a efecto esta práctica.

B) Ambos participantes deben de encontrarse preferentemente en ayunas.

C) Es recomendable que previamente hubiesen orado y meditado juntos.

D) Hay que tener preparado un pequeño Altar, que se halle libre de la curiosidad de extraños.

E) Sobre el Ara deben estar dos candeleros conteniendo cada uno tres cirios encendidos y las Sagradas Escrituras o Pistis Sofía, o mejor ambas.

F) Espada en mano El y con un Cáliz conteniendo Agua sin químicos Ella, dirán al unísono:

Por la Gloria del Señor Jehová, Invocamos las Potencias del Altísimo para conjurar y alejar de aquí todo mal. ITABABO HÁGASE LUZ. QUE ASÍ SEA.

G) Luego hay que mentalizar una Cruz o un trébol de cuatro hojas o un doble ocho dispuesto horizontal y verticalmente partiendo desde el punto central.

H) El Interion se divide en tres partes y una síntesis o Jubileo; una es positiva y masculina, operando con la Runa Inti; otra es negativa y femenina procesando la Runa Inkaos, la tercera es mixta y se ejecuta con la Runa Gibur, mientras que la Obra se sella con la Runa Krisol que es el Equiflux constituyendo la fusión de lo Humano con lo Divino, o como se llama en Lenguaje Divino al Sagrado Tetragrama: Kona-Tiki Wira-Kocha o IEVE como se le conoce entre quienes pretenden encarnarle y que aún no han adquirido la dignidad de invocarle y ver TAL COMO ES.

C) El "Modus operandi"

C1) La postura del hombre en la Runa INTI, es inclinarse casi de cuclillas extendiendo las manos hacia arriba, permitiendo que la mujer suba sobre sus hombros, agarrando aquél las manos de su pareja e irguiéndose ambos para lentamente ejecutar la respectiva Runa, comenzando con el pie izquierdo y la mano derecha de EL, llevando a cabo la Cruz en Movimiento o Cruz de Andrés a modo de pausada caminata con leve balanceo de las manos hacia adelante y atrás, tal como procedían en la Antigua Arkadía los Sacerdotes Tiahuanakotas , Mayas y Aztecas entre otros Grandes Iniciados de la Antigüedad.

Con lúcida imaginación y concentración plena, realizarán ambos el Trébol Viviente en su primer pétalo partiendo del centro hacia arriba o el Norte, a la vez que por cuatro veces mantralizan así: IIIIIIIIINNNNNNNNN TTTTTTTTTIIIIIIIII.

C2) Con el mismo procedimiento, pero esta vez con la Runa INKAOS, es la mujer quien lleva en hombros a su pareja y empezando del centro hacia abajo o el Sur, con el pie derecho y la mano izquierda, iniciarán el segundo paso soltando suavemente por cuatro veces el Mantra IIIIIIIIINNNNNNNNN KKKKKKKKKAAAAAAAAA OOOOOOOOOSSSSSSSSS cerrando el pétalo nuevamente en el centro.

C3) De igual modo como se procedió antes, pero volviendo el hombre a llevar a la mujer, la Runa GIBUR empieza con el pie derecho y la mano izquierda, iniciándose el tercer paso desde el centro hacia la derecha o el Este, diciendo por cuatro veces GGGGGGGGGIIIIIIIII BBBBBBBBBUUUUUUUUURRRRRRRRR, hasta que retornan al centro de la Mística Flor.

C4) Se finaliza esta secuencia volviendo la mujer a levantar al hombre esta vez con la Runa KRISOL, dando inicio al Equiflux con el pie izquierdo y la mano derecha, partiendo del centro hacia la izquierda diciendo cuatro veces el Mantra KKKKKKKKKRRRRRRRRRIIIIIIIII SSSSSSSSSOOOOOOOOOLLLLLLLLL hasta llegar nuevamente al centro.

C5) Erguidos ambos se dirigen al pequeño Altar para beber alternativamente el Agua contenida en el Cáliz, luego de lo cual, apagan las velas y levantan el Altar.

C6) Dentro de los siguientes veinte minutos deben proceder a ducharse, si posible con agua fría.

C7) Viviendo el más completo Amor y la más grande pureza, la pareja llega al deleite del supremo Eroar, concentrados en los pulmones desbaratando con imaginación creadora todo antiguo o reciente recuerdo de guerra, odio, ira, pleito, controversia, antipatía o enemistad, mantralizando: SSSSSSSSSOOOOOOOOOLLLLLLLLL VVVVVVVVVEEEEEEEEE.

C8) Ahora la imaginación consciente se concentra en el Corazón para decretar con el Mantra CCCCCCCCCOOOOOOOOO AAAAAAAAAGGGGGGGGGUUUUUUUUU AAAAAAAAALLLLLLLLL el Renacimiento o la Paz Espiritual con el advenimiento del Amor, la Armonía, la Dulzura, la Simpatía, la Amistad, virtudes que entre muchas otras se ven refulgir triunfantes desde nuestra Naturaleza Kristificada.

C9) Aún conectados en la Alkimia con el Sagrado Eroar, oran a la Madre Divina, visualizando la irradiación luminosa y la deliciosa fragancia perfumada que emanan del Manto de la Purísima particularizada en el Original Andrógino así renacido, aunque uniendo este fulgor al brillo singular de la Patrona de México, la clementísima Virgen Guadalupana, vigorizando la concentración consciente al enviar este Esplendor de Paz en favor de todos los estantes y habitantes de esta nuestra Madre Tierra, para que sin distinción de raza, sexo, edad, cultura, doctrina o condición social, de este singular modo recuperemos el verdadero sentido de la Navidad que nos legó el Adorable Salvador Jesús El Kristo, cuyo espíritu dimana triunfal la auténtica comunión y universalidad entre todas las especies de la Creación.

D) La secuencia regeneradora
Esta práctica debe ejecutarse en pareja constituida legítimamente los días 9 a horas 9 a.m. durante nueve meses sin soltar ni una sola vez por encima de cualquier otra obligación o tarea existente, comenzando según el calendario gregoriano en el mes de Marzo que corresponde al primero y concluyendo en Noviembre que en realidad es el noveno mes de la secuencia correcta del calendario Soli-lunar que consta de trece períodos o lunaciones y que para entonces estará en su Noveno Año.


Para concluir este Mensaje, con infinito Amor para toda la Humanidad, lanzo estas mis reflexiones:
El que Es, sabe; quien no es, ignora o duda;
Quien ignora pero duda, puede llegar a buscar;
Quien es paciente al buscar, puede llegar a encontrar;
Quien encuentra y porfía, puede llegar a entender;
Quien entiende e inquiere, puede alcanzar la Luz;
Quien alcanza la Luz y persiste en sus dones, puede encontrar la Verdad;
Quien encuentra la Verdad y la vive, aún en la materia puede volver a ser Dios;
Y quien encarna a Dios Íntimo, difunde amor y armonía
Enseñando feliz el Sendero para quienes quieran llegar a ser Dios.
Esa es la suprema razón de la auténtica Navidad.
Auguro de corazón que todos encuentren la Paz para que puedan vivir en progresivo Renacimiento Espiritual, regocijándose no sólo un día, sino más bien toda la Eternidad.
Desde mi Real Ser para todos: AMOR Y SABIDURIA SEAN CON VOSOTROS:

Por la materia física: Dr. David Serrate Pérez
Kent, Washington, E.U.N.A., Invierno Boreal del Octavo Año de la Nueva Era Acuaria
Sede Suprema de Salem Itinerante, Diciembre 21 del Año 2001

No hay comentarios:

Publicar un comentario